| DRED ID | Disease Name | OMIM | Repeat Unit | Repeat Location | Gene |
|---|---|---|---|---|---|
| RD00001 | Spinocerebellar Ataxia 1 | 164400 | CAG | CDS | ATXN1 |
| RD00002 | Spinocerebellar Ataxia 2 | 183090 | CAG | CDS | ATXN2 |
| RD00003 | Spinocerebellar Ataxia 3 | 109150 | CAG | CDS | ATXN3 |
| RD00004 | Spinocerebellar Ataxia 6 | 183086 | CAG | CDS | CACNA1A |
| RD00005 | Spinocerebellar Ataxia 7 | 164500 | CAG | CDS | ATXN7 |
| RD00006 | Spinocerebellar Ataxia 17 | 607136 | CAG | CDS | TBP |
| RD00007 | Spinal and Bulbar Muscular Atrophy | 313200 | CAG | CDS | AR |
| RD00008 | Dentatorubral-Pallidoluysian Atrophy, Naito-Oyanagi Disease | 125370 | CAG | CDS | ATN1 |
| RD00009 | Huntington Disease | 143100 | CAG | CDS | HTT |
| RD00010 | Spinocerebellar Ataxia 8 | 608768 | CAG | CDS | ATXN8 |
| RD00011 | Spastic Paraplegia 4, Autosomal Dominant | 182601 | CAG | CDS | SPAST |
| RD00012 | Creutzfeldt-Jakob Disease | 123400 | CCTCATGGTGGTGGCTGGGGGCAG | CDS | PRNP |
| RD00013 | Epiphyseal Dysplasia, Multiple, 1 | 132400 | GAC | CDS | COMP |
| RD00014 | Vacterl Association, X-linked, with or without Hydrocephalus | 314390 | GCC | CDS | ZIC3 |
| RD00015 | Neuropathy, Hereditary Sensory and Autonomic, Type VIII | 616488 | GCC | CDS | PRDM12 |
| RD00016 | Amyotrophic Lateral Sclerosis 1 | 105400 | GCG | CDS | NIPA1 |