Creutzfeldt-Jakob Disease (PRNP)
| Dred_ID | RD00012 |
| OMIM ID | 123400 |
| Disease name | Creutzfeldt-Jakob Disease |
| Alternative names | CJD |
| Category | Genetic diseases, Rare diseases, Infectious diseases |
| Phenotype | OMIM: The human prion diseases occur in inherited, acquired, and sporadic forms. Approximately 15% are inherited and associated with coding mutations in the PRNP gene. Acquired prion diseases include iatrogenic CJD, kuru (245300), variant CJD (vCJD) in humans, scrapie in sheep, and bovine spongiform encephalopathy (BSE) in cattle. Variant CJD is believed to be acquired from cattle infected with BSE. However, the majority of human cases of prion disease occur as sporadic CJD (sCJD) (Collinge et al., 1996; Parchi et al., 2000; Hill et al., 2003). Johnson and Gibbs (1998) provided a comprehensive review of Creutzfeldt-Jakob disease and related transmissible spongiform encephalopathies. Tyler (2003) described the characteristics of sporadic CJD as encapsulated by C. Miller Fisher in 1960. UniProtKB/Swiss-Prot: Occurs primarily as a sporadic disorder (1 per million), while 10-15% are familial. Accidental transmission of CJD to humans appears to be iatrogenic (contaminated human growth hormone (HGH), corneal transplantation, electroencephalographic electrode implantation, etc.). Epidemiologic studies have failed to implicate the ingestion of infected animal meat in the pathogenesis of CJD in human. The triad of microscopic features that characterize the prion diseases consists of (1) spongiform degeneration of neurons, (2) severe astrocytic gliosis that often appears to be out of proportion to the degree of nerve cell loss, and (3) amyloid plaque formation. CJD is characterized by progressive dementia and myoclonic seizures, affecting adults in mid- life. Some patients present sleep disorders, abnormalities of high cortical function, cerebellar and corticospinal disturbances. The disease ends in death after a 3-12 months illness. |
| Miscellaneouse | most cases are sporadic mean age at onset for sporadic cjd is 60 years (range, 50 to 70 years) mean age at onset for variant cjd is 29 years (before age 45 years) rapid progression mean survival 5 months three forms of cjd: acquired (including variant), sporadic, and inherited incidence of all forms of cjd is 0.5 to 1.5 per million per year 15% cases are familial patients with variant cjd are homozygous for met129 polymorphism |
| Prevalence | Prevalence: 1-9/1000000 (Australia) [source: MalaCards] |
| Inheritance | Autosomal dominant |
| Anticipation | Yes |
| Evidence | Strong |
| Gene symbol | PRNP |
| Alias symbols | CJD; GSS; PrP; ASCR; KURU; PRIP; PrPc; CD230; AltPrP; p27-30; PrP27-30; PrP33-35C |
| Gene name | prion protein |
| Gene map locus | 20p13; chr20:4,686,350-4,701,590(+) |
| Ensembl Gene ID | ENSG00000171867 |
| Gene expression and Gene Ontology | BioGPS |
| Protein expression | Human Protein Atlas |
| Gene sequence | Sequence |
| Variation | ClinVar, dbSNP | Gene conservation | Gene Conservation from UCSC Genome Browser |
| Gene Description | The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. |
| Repeat unit | CCTCATGGTGGTGGCTGGGGGCAG |
| Normal repeat copies | 5 |
| Pathogenic repeat copies | ≥10 |
| Gene | PRNP |
| Repeat location | CDS |
| Chromosome locus | chr20:4699398-4699446 (+) |
| Repeat conservation | Repeat Conservation from UCSC Genome Browser |
| Toxic cause | Protein |
| Possible toxicity | Point and octapeptide repeat (24 bp) insertional mutations in the prion protein gene (PRNP) cause a dominantly transmitted dementia, associated with spongiform degeneration of the brain, astrocytic gliosis and neuronal loss due to cell accumulation of mutated protease resistant prion protein. The octapeptide repeat region lies between codon 51 and 91, and comprises a nonapeptide followed by a tandem repeat containing four copies of an octapeptide. The normal tandem length in healthy individuals is five repeats R1-R2-R2-R3-R4, but mutations can contain up to nine additional extra repeats. Some insight into this genetic mechanism comes from the de novo meiotic insertional extra repeat mutation in PRNP we detected in a patient whose parents had a normal phenotype and a wild-type sequence in the same gene. |
| Pathway annotation | Reactome, KEGG |
| PMID | 21686668 |
| Authors | M Cannella, Tiziana Martino, Maria Simonelli, Andrea Ciammola, et al. |
| Title | De novo seven extra repeat expanded mutation in the PRNP gene in an Italian patient with early onset dementia |
| Journal | BMJ Case Rep. |
| Year | 2009 |