| General information of RDP00543 | |
|---|---|
| Gene Symbol: | AZIN1 | 
| RefSeq ID: | NM_001301668 | 
| Repeat coordinate: | chr8:102863626-102863647 (-) | 
| Repeat size: | 7 | 
| Repeat region: | intron | 
| Repeat unit: | CGG | 
| Repeat conservation: | PhastCons_score: 0.004; Repeat Conservation from UCSC Genome Browser | 
| Amino acid sequence: | - | 
| Gene expression and GO annotation: | BioGPS | 
| Protein expression: | Human Protein Altas | 
| Gene conservation: | Gene Conservation from UCSC Genome Browser | 
| Mapping repeat track to 1000 Genomes: | 
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
8
102863626
.
CCCG
C
100
| Mapping repeat track to gnomAD: | 
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
8
102863613
.
CCCGCCGCCCAGCCCCG
C
587.94
8
102863626
rs371296627
CCCGCCG
CCCG,C,CCCGCCGCCG,CCCGCCGCCGCCG
7176563.91
8
102863631
.
CGCCGCCGCCGCCGCCGGGGGCACAGACA
C
99691.22
8
102863635
.
G
A
6182.37
8
102863637
.
CGCCGCCGCCGGGGGCACAGACA
C
3575.30
8
102863644
.
GCC
G
1172.49
| Mapping repeat track to Kaviar: | 
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
8
102863613
.
CCCGCCGCCCAGCCCCGCCGCCGCCGCCG
CCCGCCGCCCAGCCCCGCCGCCGCCG
.
8
102863623
.
AGCCCCG
AGCC
.
8
102863626
.
CCCG
C
.
8
102863626
rs371296627
CCCG
C
.
8
102863629
.
G
C
.
8
102863645
.
C
G
.
8
102863646
.
C
G
.