| General information of RDP00517 | |
|---|---|
| Gene Symbol: | ATRN |
| RefSeq ID: | NM_001207047 |
| Repeat coordinate: | chr20:3471357-3471375 (+) |
| Repeat size: | 6 |
| Repeat region: | intron |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.368; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Nerve Degeneration | NM_001207047 | 0.30 | 1 | 0 | CTD_human |
| Mapping repeat track to ESP: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
20
3471356
.
CGCG
C
.
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
20
3471347
.
GGCCGAGGCCGCGGCGGCGGCGGCGGCGGTGTCGGGCTCAGCCGCA
AGCCGAGGCCGCGGCGGCGGCGGCGGCGGTGTCGGGCTCAGCCGCA,G
298.59
20
3471356
rs766824235
CGCGGCG
CGCG,CGCGGCGGCG,CGCGGCGGCGGCG,C
481043.29
20
3471359
.
G
C
440110.55
20
3471360
.
G
A
2392.28
20
3471365
.
G
A
364.43
20
3471367
rs542464289
C
T
575.52
20
3471370
.
CGGCGGT
TGGCGGT,C,CGGCGGTGGCGGT
996.93
20
3471371
rs762116548
G
A
3264.22
20
3471373
.
C
T
3155.19
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
20
3471356
rs766824235
CGCGGCGGCG
CGCGGCG,CGCGGCGGCGGCG,CGCGGCGGCGGCGGCG,C
5858.16
20
3471361
.
CGGCGGCGGCGGCGGT
C
1062.84
20
3471367
rs542464289
C
T
1235.14
20
3471369
.
GCGGCGGTGT
G
911.43
20
3471371
rs762116548
G
A
2829.08
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
20
3471356
rs761060489
CGCG
C,CGCGGCG,CGCGGCGGCG
.
20
3471361
.
C
G
.
20
3471367
rs542464289
C
G,T
.
20
3471370
.
CG
GC
.
20
3471371
rs762116548
G
A
.