| General information of RDP00504 | |
|---|---|
| Gene Symbol: | RGPD2 |
| RefSeq ID: | NM_001078170 |
| Repeat coordinate: | chr2:86914420-86914474 (+) |
| Repeat size: | 18 |
| Repeat region: | intron |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.679; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
2
86914418
.
GGGCGGCGGCGGCGGCGGC
GGGCGGC,GGGCGGCGGC,GGGCGGCGGCGGCGGC,GGGCGGCGGCGGC,GGGC,G
16772.88
2
86914454
.
CGG
C
14692.39
2
86914458
.
GGCGGCGGCGGCGGCGGCCT
G
13517.49