| General information of RDP00447 | |
|---|---|
| Gene Symbol: | SMCO4 |
| RefSeq ID: | NM_020179 |
| Repeat coordinate: | chr11:93543240-93543258 (-) |
| Repeat size: | 6 |
| Repeat region: | intron |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.000; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
11
93543240
.
CCCGCCG
CCCGCCGCCGCCG,CCCG,C,CCCGCCGCCG
13071.69
11
93543247
.
CCGCCGCCGCCGCGCCGCTCCCAGCCCACCTGCCCGCGGG
C
290.28
11
93543258
.
G
GC
627.57
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
11
93543242
.
C
CG
.