| General information of RDP00433 | |
|---|---|
| Gene Symbol: | HIPK1 |
| RefSeq ID: | NM_152696 |
| Repeat coordinate: | chr1:113929713-113929731 (+) |
| Repeat size: | 6 |
| Repeat region: | intron |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.999; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Gastrointestinal Stromal Sarcoma | NM_152696 | 0.30 | 1 | 0 | CTD_human |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
113929711
rs774270345
AGGC
A,AGGCGGCGGCGGC,AGGCGGC,AGGCGGCGGC
37249.20
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
113929697
.
AGCGCGCGGGGCTGAGGCGGC
AGAGCGCGGGGCTGAGGCGGC
.
1
113929729
.
C
CG
.