| General information of RDP00399 | |
|---|---|
| Gene Symbol: | URI1 | 
| RefSeq ID: | NM_001252641 | 
| Repeat coordinate: | chr19:30009236-30009251 (+) | 
| Repeat size: | 5 | 
| Repeat region: | CDS | 
| Repeat unit: | GAC | 
| Repeat conservation: | PhastCons_score: 0.022; Repeat Conservation from UCSC Genome Browser | 
| Amino acid sequence: | DDDDD | 
| Gene expression and GO annotation: | BioGPS | 
| Protein expression: | Human Protein Altas | 
| Gene conservation: | Gene Conservation from UCSC Genome Browser | 
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source | 
| Malignant neoplasm of ovary | NM_001252641 | 0.31 | 1 | 0 | CTD_human | 
| Mapping repeat track to ExAC: | 
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
19
30009233
rs61757645
TGATGACGAC
TGAC,T,CGATGACGAC,TGACGATGACGAC
29072.90
19
30009236
rs1127493
TGAC
T,CGAC,TGACGAC
946599.65
19
30009241
rs753508308
A
G
8723.11
19
30009242
rs754868386
C
T
12597.55
19
30009243
rs778801300
G
A
2842.82
19
30009244
rs748149375
A
G
2510.46
19
30009245
rs548585247
C
T
52252.67
19
30009246
rs781346860
G
A
19554.19
19
30009248
rs745994162
C
T,CAACATT
23529.69
19
30009249
rs769862941
G
A
7507.41
| Mapping repeat track to gnomAD: | 
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
19
30009233
rs61757645
TGATGACGAC
TGAC,TGACGATGACGAC,T
6943.91
19
30009235
.
ATG
A,ACGACGACGACGACAACATTG
7084.69
19
30009236
rs1127493
TGACGAC
TGAC,CGACGAC,TGACGACGAC,TGACGACGACGAC,T
77092.93
19
30009238
.
AC
A
13060.28
19
30009245
rs548585247
C
T
1222.18
19
30009246
rs781346860
G
A
851.42
19
30009248
rs745994162
C
T
1146.17
19
30009249
rs769862941
GACA
AACA,G
3922.76
| Mapping repeat track to Kaviar: | 
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
19
30009229
.
ATGATGATG
ATG,ATGATG
.
19
30009233
.
TGATGA
TGA
.
19
30009233
rs775535103
TGATGAC
T
.
19
30009233
rs762956491
TGATGACGAC
T
.
19
30009235
.
ATGA
A
.
19
30009236
.
TGAC
CGAC,T
.
19
30009236
rs774754630
TGAC
T
.
19
30009239
rs113183389
C
T
.
19
30009241
rs753508308
A
G
.
19
30009242
rs754868386
C
T
.
19
30009243
rs778801300
G
A,C
.
19
30009244
rs748149375
A
G
.
19
30009245
rs548585247
C
T
.
19
30009246
rs781346860
G
A
.
19
30009248
rs745994162
C
CAACATT,T
.
19
30009248
rs762192640
C
CAACATT
.
19
30009249
rs769862941
G
A
.