| General information of RDP00299 | |
|---|---|
| Gene Symbol: | LMO2 |
| RefSeq ID: | NM_005574 |
| Repeat coordinate: | chr11:33869483-33869501 (-) |
| Repeat size: | 6 |
| Repeat region: | CDS |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.871; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | GGGGG |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to OMIM: | ||
|---|---|---|
| Phenotype | OMIM_id | Location |
| Leukemia, acute T-cell (2) | 180385 | 11p13 |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Precursor T-Cell Lymphoblastic Leukemia-Lymphoma | NM_005574 | 0.40 | 2 | 0 | CTD_human |
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
11
33869439
rs548583380
GGCTGGCCGGCTGCCGGGGCTCGGACCCCCTCGGGTGCTCGGGCGCCGCCGCCGCCGCCGCCGTCGCCGCCGCTCCTGCGCCTCCGCTT
G
184.34
11
33869481
rs780680772
GCGCCGCCGCCGC
G,GCGCCGCCGC,GCGCCGCCGCCGCCGC,ACGCCGCCGCCGC
35503.48
11
33869486
.
G
A
5919.77
11
33869490
.
CCGCCGCCGCCGTCGCCGCCGCTCCTG
C,CCGCCGCCGCTCCTG
7576.55
11
33869492
.
G
A
7839.17
11
33869499
.
C
T
2957.63
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
11
33869481
rs780680772
GCGCCGCCGCCGCCGCCGCCGT
GCGCCGCCGCCGCCGCCGCCGCCGT,GCGCCGCCGCCGCCGCCGCCGCCGCCGT,GCGCCGCCGT,G,GCGCCGCCGCCGCCGT,GCGCCGCCGCCGT
13996.09
11
33869487
.
CCGCCGCCGCCGCCGT
C
9252.66
11
33869490
.
C
CCGCCGCCGCCGT
9947.87
11
33869493
.
CCGCCGCCGT
C,CCGCCGCCGTCGCCGCCGT
10171.22
11
33869497
.
C
T
1987.71
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
11
33869481
rs780680772
GCGC
G
.
11
33869486
.
G
A
.
11
33869486
.
G
GC
.
11
33869492
.
G
GC
.
11
33869501
.
G
A
.