| General information of RDP00286 | |
|---|---|
| Gene Symbol: | MNX1 |
| RefSeq ID: | NM_005515 |
| Repeat coordinate: | chr7:157009950-157009977 (-) |
| Repeat size: | 9 |
| Repeat region: | CDS |
| Repeat unit: | CCG |
| Repeat conservation: | PhastCons_score: 0.091; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | AAAAAAAA |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to OMIM: | ||
|---|---|---|
| Phenotype | OMIM_id | Location |
| Currarino syndrome, 176450 (3) | 142994 | 7q36.3 |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Anorectal Malformations | NM_005515 | 0.31 | 1 | 0 | GENOMICS_ENGLAND |
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
157009949
rs548755417
AGCG
AGCGGCGGCG,A,AGCGGCG
17449.18
7
157009957
.
C
CGGCGGT
95.96
7
157009973
.
GGCGGCA
G
63.53
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
157009949
rs548755417
AGCGGCGGCGGCG
AGCGGCGGCGGCGGCGGCG,AGCGGCGGCGGCGGCGGCGGCG,AGCGGCGGCGGCGGCGGCGGCGGCG,AGCGGCGGCGGCGGCG,A,AGCGGCGGCG
7741922.81
7
157009953
.
G
GCGGCGA
35650.48
7
157009955
.
G
GGCGGCGA
35643.46
7
157009964
.
G
GGCGGCGGCGGCGGCT
257.86
7
157009973
.
G
GGCGGCGGCGGCA
5684.85
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
157009949
.
AGCGGCG
A
.
7
157009949
.
AGCGGCGGCGGCG
A
.
7
157009963
.
C
CG
.