| General information of RDP00284 | |
|---|---|
| Gene Symbol: | ZSWIM6 |
| RefSeq ID: | NM_020928 |
| Repeat coordinate: | chr5:61332792-61332822 (+) |
| Repeat size: | 10 |
| Repeat region: | CDS |
| Repeat unit: | CCG |
| Repeat conservation: | PhastCons_score: 0.532; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | AAAAAAAAA |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to OMIM: | ||
|---|---|---|
| Phenotype | OMIM_id | Location |
| Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, 617865 (3) | 615951 | 5q12.1 |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| NEURODEVELOPMENTAL DISORDER WITH MOVEMENT ABNORMALITIES, ABNORMAL GAIT, AND AUTISTIC FEATURES | NM_020928 | 0.40 | 1 | 1 | GENOMICS_ENGLAND |
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
5
61332791
.
TGCC
T
936.69
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
5
61332761
.
GGCGGCCGCAACCTCGGCCGCCGCCGCCGCTGCCGCCGCCGCCGCC
GGCCGCC,GGCCGCCGCC,G,GGCCGCCGCCGCC,GGCCGCCGCCGCCGCC
8487157.65
5
61332791
.
TGCCGCCGCC
TGCCGCCGCCGCC,TGCC,T,TGCCGCC,CGCCGCCGCC
210287.44
5
61332793
.
C
G
55447.82
5
61332794
rs867108301
C
A
55608.60
5
61332797
.
C
G
34723.94
5
61332804
.
G
T
3563.48
5
61332806
.
C
CTCG
3286.77
5
61332821
.
C
T
108.20
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
5
61332761
.
GGCGGCCGCAACCTCGGCCGCCGCCGCCGCTGCCGCCGCCGCCGCC
G
.