| General information of RDP00234 | |
|---|---|
| Gene Symbol: | EPB41L4B |
| RefSeq ID: | NM_018424 |
| Repeat coordinate: | chr9:109320698-109320716 (-) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.011; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
9
109320666
.
GGCCGCAGGCGGGAGGGCGCGCTCGGGGCCGTCCC
G
504.17
9
109320698
.
CCCGCCGCCG
CCCGCCGCCGCCG,CCCGCCGCCGCCGCCG,CCCGCCG,C
25342.95