| General information of RDP00213 | |
|---|---|
| Gene Symbol: | BMT2 |
| RefSeq ID: | NM_152556 |
| Repeat coordinate: | chr7:112939757-112939775 (-) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.951; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to ESP: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
112939756
.
AGCC
A,AGCCGCC
.
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
112939756
rs561551146
AGCCGCCGCC
AGCCGCC,AGCCGCCGCCGCC,AGCCGCCGCCGCCGCC,AGCC,AGCCGCCGCCGCCGCCGCC,A
1630236.52
7
112939760
rs139022599
G
T,A
1528597.70
7
112939761
rs771329339
C
T
19272.70
7
112939763
rs776943747
G
T
4306.61
7
112939764
.
C
T
3975.41
7
112939765
rs760110254
C
G
4012.93
7
112939766
rs763656802
G
A
831.95
7
112939768
rs751082641
C
G
1591.01
7
112939775
rs761458873
G
A,T,GC
1489.75
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
112939756
rs561551146
AGCCGCCGCC
AGCCGCCGCCGCC,AGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCCGCC,A,AGCC
195949.79
7
112939760
rs139022599
G
T
639205.82
7
112939761
rs771329339
C
T
992.11
7
112939765
rs760110254
C
T
1202.11
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
7
112939756
.
AGCC
A
.
7
112939756
rs753513797
AGCC
A
.
7
112939756
rs750217713
AGCCGCC
A
.
7
112939756
rs756028692
AGCCGCCGCC
A,AGCC,AGCCGCC,AGCCGCCGCCGCC,AGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCC
.
7
112939758
.
CCG
CCCG,CCT
.
7
112939760
rs139022599
G
T
.
7
112939761
rs771329339
C
T
.
7
112939763
rs776943747
G
T
.
7
112939765
rs760110254
C
G
.
7
112939766
rs763656802
G
A
.
7
112939768
rs751082641
C
G
.
7
112939775
rs761458873
G
A
.