| General information of RDP00197 | |
|---|---|
| Gene Symbol: | UBE2QL1 |
| RefSeq ID: | NM_001145161 |
| Repeat coordinate: | chr5:6448732-6448750 (+) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.087; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
5
6448723
.
CCGGCGGCTGCGGCGGCGGCGG
C,CCGGCGGCGGCTGCGGCGGCGGCGG,CCGGCGGCGGCGGCGGCTGCGGCGGCGGCGG
102390.51
5
6448732
.
GCGGCGGCGGCGGCGGCGGCT
G
112521.10
5
6448734
.
GGCGGCGGCGGCGGCGGCT
G
6432
5
6448737
.
GGCGGCGGCGGCGGCT
G
21905.43
5
6448739
.
C
G
43848.37
5
6448740
.
GGCGGCGGCGGCT
TGCGGCGGCGGCT,G
44940.39
5
6448743
.
GGCGGCGGCT
G,GGCTGCGGCGGCT
73577.83
5
6448746
.
GGCGGCT
G,TGCGGCT
89850.15
5
6448749
.
GGCT
G
113398.24
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
5
6448725
.
GGCGGCTGCGGCGGCGGCGGCGGCGGCT
AGATTAAAAAAAGAGGAAGAGAGAGTTTAAT
.
5
6448746
.
GGCGGCT
G
.
5
6448749
.
GGCT
G
.