| General information of RDP00167 | |
|---|---|
| Gene Symbol: | PMEPA1 |
| RefSeq ID: | NM_020182 |
| Repeat coordinate: | chr20:57709916-57709937 (-) |
| Repeat size: | 7 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.970; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Liver Cirrhosis, Experimental | NM_020182 | 0.30 | 1 | 0 | CTD_human |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
20
57709916
.
TCCGCCGCCG
TCCGCCG,T,TCCGCCGCCGCCG,TCCG,TCCGCCGCCGCCGCCGCCGCCG
7401.88
20
57709937
.
G
T
195.52
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
20
57709921
.
C
CG
.
20
57709932
.
C
T
.