| General information of RDP00150 | |
|---|---|
| Gene Symbol: | SAMD4B |
| RefSeq ID: | NM_001303614 |
| Repeat coordinate: | chr19:39342442-39342466 (+) |
| Repeat size: | 8 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.999; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
19
39342442
.
ACGGCGGCGG
ACGGCGGCGGCGG,ACGGCGG,A,ACGGCGGCGGCGGCGG,ACGGCGGCGGCGGCGGCGG,GCGGCGGCGG
75648.45
19
39342444
.
G
A
9070.51
19
39342455
.
CGGCGGCGGCGGTGGTCGGTGCGGGAGGAGGGAGGGGAGCTTGCGGGCCCGAGAGGG
C
54.58
19
39342458
.
CGGCGGCGGT
C
361.88