| General information of RDP00134 | |
|---|---|
| Gene Symbol: | MIB1 |
| RefSeq ID: | NM_020774 |
| Repeat coordinate: | chr18:21741536-21741554 (+) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.847; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to OMIM: | ||
|---|---|---|
| Phenotype | OMIM_id | Location |
| Left ventricular noncompaction 7, 615092 (3) | 608677 | 18q11.2 |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Generalized Absence Seizures | NM_020774 | 0.30 | 1 | 0 | CTD_human |
| Mapping repeat track to ClinVar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
18
21741535
422751
AGCGGCGGCGGCGGCG
A
.
| Mapping repeat track to ESP: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
18
21741535
.
AGCG
A
.
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
18
21741535
rs528731305
AGCGGCGGCGGCGGCG
AGCGGCGGCGGCG,AGCGGCGGCG,A,AGCGGCG,AGCGGCGGCGGCGGCGGCG
133793.63
18
21741538
rs542215308
G
A
65942.36
18
21741544
rs746418633
GGCGGCGGCGGCA
G
9669.35
18
21741547
.
G
GGCGGCGGCA
973.34
18
21741553
.
G
A
462.42
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
18
21741527
rs536200133
CCGGCGGCAGCGGCGGCGGCGG
CCGGCGGCAGCGGCGGCGGCGGCGGCGGCAGCGGCGGCGGCGG,C
1262.24
18
21741535
rs528731305
AGCGGCGGCG
AGCGGCG,GGCGGCGGCG,AGCGGCGGCGGCGGCGGCG,AGCGGCGGCGGCG,A,AGCGGCGGCGGCGGCG
11025.97
18
21741538
rs542215308
G
A
37934.95
18
21741544
rs746418633
G
GGCGGCGGCGGCA
3609.41
18
21741550
.
G
GGCGGCA
2947.10
18
21741553
.
G
GGCA
286.53
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
18
21741527
rs536200133
CCGGCGGCAGCGGCGGCGGCGG
C
.
18
21741535
rs755675508
AGCG
A
.
18
21741535
.
AGCGGCG
A
.
18
21741535
rs777227722
AGCGGCGGCG
A,AGCGGCG
.
18
21741538
rs542215308
G
A
.
18
21741542
.
G
GC
.
18
21741544
rs746418633
GGCGGCGGCGGCA
G
.