| General information of RDP00122 | |
|---|---|
| Gene Symbol: | PPP4C |
| RefSeq ID: | NM_001303503 |
| Repeat coordinate: | chr16:30076007-30076031 (+) |
| Repeat size: | 8 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.959; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
16
30076006
rs536280015
AGCGGCG
AGCG,AGCGGCGGCGGCGGCGGCGGCG,AGCGGCGGCGGCGGCG,AGCGGCGGCGGCG,A,AGCGGCGGCG
816845.36
16
30076008
.
C
T
158514.23
16
30076012
.
G
GGCA
138830.41
16
30076023
.
CGGCGGCGGT
C
637.48
16
30076029
.
CGGT
C
7110.67
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
16
30076006
.
AGCG
A
.
16
30076006
rs573742271
AGCGGCG
A
.
16
30076006
rs571404583
AGCGGCGG
A,AG
.
16
30076006
.
AGCGGCGGCGGCG
A
.
16
30076012
.
G
GGCA
.
16
30076017
.
C
CG
.
16
30076029
.
C
CG
.
16
30076029
.
C
CG
.
16
30076031
.
G
GC
.