| General information of RDP00117 | |
|---|---|
| Gene Symbol: | ST3GAL2 |
| RefSeq ID: | NM_006927 |
| Repeat coordinate: | chr16:70439024-70439048 (-) |
| Repeat size: | 8 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.154; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
16
70438992
.
GGCCGCCGCCGCCGCCCGCGCAGAAAGCCGTCGCCGCCGCCGCC
GGCCGCCGCCGCCGCCGCCCGCGCAGAAAGCCGTCGCCGCCGCCGCC,GGCCGCCGCCGCCGCCCGCGCAGAAAGCCGTCGCCGCCGCCGCCGCCCGCGCAGAAAGCCGTCGCCGCCGCCGCC,GGCCGCCGCC,G
60247.77
16
70439022
rs567688682
TCGCCGCCGC
TCGCCGCCGCCGCCGC,TCGCCGCCGCCGC,T,TCGC,TCGCCGCCGCCGCCGCCGC
246688.40
16
70439034
.
C
A
5189
16
70439038
.
C
CGCA
39844.10
16
70439040
.
C
CCGCCGCCGT,T
3923.83
16
70439046
rs543275979
C
T,CCGT
3478.39
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
16
70439022
.
TCGC
T
.
16
70439036
.
G
GC
.
16
70439037
.
CCG
CCGC
.
16
70439038
.
CGC
CCG
.
16
70439038
.
C
CGCA
.
16
70439042
.
G
GC
.
16
70439046
rs543275979
C
T
.