| General information of RDP00092 | |
|---|---|
| Gene Symbol: | KCTD12 |
| RefSeq ID: | NM_138444 |
| Repeat coordinate: | chr13:76886258-76886276 (-) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.006; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Mood Disorders | NM_138444 | 0.30 | 1 | 0 | PSYGENET |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
13
76886258
.
CCCGCCGCCG
CCCGCCG,CCCG,CCCGCCGCCGCCG,C,CCCGCCGCCGCCGCCG,CCCGCCGCCGCCGCCGCCGCCGCCGCCG
690430.96
13
76886264
.
GCCGCCGCCGCCGCCA
G
568809.20
13
76886267
.
GCCGCCGCCGCCA
GCCGCCACCGCCGCCGCCA,G,GCCGCCGCCGCCACCGCCGCCGCCA
18947.95
13
76886270
rs750741203
GCCGCCGCCACCGCCGCCA
GCCGCCGCCACCGCCGCCACCGCCGCCA,GCCACCGCCGCCACCGCCGCCA,GCCGCCGCCA,ACCGCCGCCACCGCCGCCA,G
112015.51
13
76886273
rs190847367
GCCGCCACCGCCGCCA
ACCGCCACCGCCGCCA,G,GCCGCCACCGCCGCCACCGCCACCGCCGCCA
738501.22
13
76886276
.
GCCA
ACCA,G
123984.21
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
13
76886258
.
CCCG
C
.
13
76886258
.
CCCGCCG
C
.
13
76886258
.
CCCGCCGCCG
C
.
13
76886264
.
G
C
.
13
76886264
.
GCCGCCGCCGCCGCCACCGCCG
ACCGCCG,GCCGCCGCCACCGCCACCGCCG,GCCGCCGCCGCCGCCACCGCCGCCA,GCCGCCGCCGCCGCCACCGCCGCCACTG
.
13
76886270
rs555597920
G
A
.
13
76886270
rs750741203
G
GCCGCCGCCA
.
13
76886270
.
GCCGCCGCCA
G
.
13
76886271
.
CCG
CCA
.
13
76886273
rs190847367
G
A
.
13
76886273
.
GCCGCCACCGCCGCCA
GCCGCCACCGCCGCCACCA,G
.
13
76886276
.
G
A
.