| General information of RDP00088 | |
|---|---|
| Gene Symbol: | USP30 |
| RefSeq ID: | NM_032663 |
| Repeat coordinate: | chr12:109052621-109052639 (+) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.024; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
109052633
.
G
GCGGCGA
175.65
12
109052634
.
C
CGGCGGT
299.14
12
109052637
.
C
T,CGGT,CGGCGGT
2543.72
12
109052638
rs751331290
G
A
278.10
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
109052621
rs140371213
CCGG
CCGGCGGCGG,CCGGCGG,C,CCGGCGGCGGCGGCGG,CCGGCGGCGGCGG,CCGGCAGCGG
10917735.67
12
109052626
.
G
GGCGGCA,GGCGGCGGCGGCGGCGGCGGTA
2096.16
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
109052621
rs3217401
CCGG
CCGGCGG,CCGGCGGCGG,CCGGCGGCGGCGG,C
.
12
109052626
.
G
GGCGGCA
.
12
109052638
rs751331290
G
A
.