| General information of RDP00082 | |
|---|---|
| Gene Symbol: | GNPTAB |
| RefSeq ID: | NM_024312 |
| Repeat coordinate: | chr12:101830714-101830735 (-) |
| Repeat size: | 7 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.779; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to OMIM: | ||
|---|---|---|
| Phenotype | OMIM_id | Location |
| Mucolipidosis III alpha/beta, 252600 (3) | 607840 | 12q23.2 |
| Mapping repeat track to DisGeNET: | |||||
|---|---|---|---|---|---|
| Disease_name | RefSeq | Score | NofPmids | NofSnps | Source |
| Mucolipidosis 2 | NM_024312 | 0.30 | 1 | 0 | ORPHANET |
| Mapping repeat track to ClinVar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
101830713
261693
AGCC
A
.
| Mapping repeat track to ESP: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
101830713
rs76300806
AGCC
A,ACC
.
| Mapping repeat track to ExAC: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
101830711
rs779760386
TGAGCCGCCGCCGCCGCCGCCGCCGCCTCAGC
T
1869.26
12
101830713
rs748324955
AGCCGCCGCCGCC
AGCCGCCGCC,AGCCGCC,AGCC,AGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCC,A
85578571.64
12
101830715
.
C
T,A
85378250.63
12
101830716
rs564900578
C
CT,T,CTGA
85386201.05
12
101830717
rs771542610
GCCGC
G,TCCGC
7154436.01
12
101830718
.
C
G
6671716.96
12
101830719
.
C
A
6664263.27
12
101830720
.
G
A
289591.92
12
101830722
rs776540837
C
T,A
288690.71
12
101830724
.
C
T
63225.38
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
101830713
rs748324955
AGCCGCCGCC
AGCC,AGCCGCC,AGCCGCCGCCGCC,A,AGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCC
10575839.31
12
101830716
rs564900578
C
CTGA
10554005.44
12
101830717
rs771542610
G
T
127749.53
12
101830718
.
C
G
52259.83
12
101830719
.
C
A
52259.86
12
101830735
.
G
A
346.34
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
101830711
rs779760386
TGAGCCGCCGCCGCCGCCGCCGCCGCCTCAGC
T
.
12
101830713
.
AGCC
A
.
12
101830713
.
AGCCGCCGCC
A
.
12
101830713
rs766382404
AGCC
A
.
12
101830713
rs776938736
AGCCGCC
A,AGCC
.
12
101830713
rs771291213
AGCCGCCGCC
A,AGCCGCC
.
12
101830713
rs773422595
AGCCGCCGCCGCC
A,AGCC,AGCCGCC,AGCCGCCGCC,AGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCC
.
12
101830714
.
GCCGCCGCCGC
GCCGCCGC
.
12
101830716
rs564900578
C
A,T
.
12
101830716
rs763614126
C
CT
.
12
101830717
rs771542610
GCCGC
G
.
12
101830722
rs776540837
C
A
.
12
101830734
.
C
CG
.
12
101830735
.
G
T
.