| General information of RDP00081 | |
|---|---|
| Gene Symbol: | FBXL14 |
| RefSeq ID: | NM_152441 |
| Repeat coordinate: | chr12:1594157-1594181 (-) |
| Repeat size: | 8 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.009; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
1594156
rs563440973
AGCCGCC
AGCCGCCGCC,AGCCGCCGCCGCCGCCGCC,AGCC,A,AGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCCGCCGCCGCC
12087437.75
12
1594159
.
C
CGCT
1273733.61
12
1594160
.
G
GCCA
207595.99
12
1594162
.
C
T
205235.41
12
1594168
.
C
CGCT
2245.57
12
1594171
.
C
CGCCGCT
1199.44
12
1594173
.
C
A
1556.57
12
1594174
.
C
CGCT
1067.09
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
12
1594156
rs544992054
AGCC
A,AGCCGCC
.
12
1594156
.
AGCCGCC
A,AGCCGCCGCC
.
12
1594156
.
AGCCGCCGCC
A
.
12
1594168
.
C
CG
.