| General information of RDP00054 | |
|---|---|
| Gene Symbol: | ABL2 |
| RefSeq ID: | NM_001136001 |
| Repeat coordinate: | chr1:179229634-179229652 (-) |
| Repeat size: | 6 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.097; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to OMIM: | ||
|---|---|---|
| Phenotype | OMIM_id | Location |
| Leukemia, acute myeloid, with eosinophilia (1) | 164690 | 1q25.2 |
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
179229622
.
CGCGCCCCCAACGCCGCCGCCGCCG
C
159.94
1
179229623
.
GCGCCCCCAACGCCGCCGCCGCCGC
G
1040.90
1
179229628
.
CCCAACGCCGCCGCCGCCGCCGCCG
C
1737.70
1
179229632
rs555665593
ACGC
ACGCCGCCGC,ACGCCGC,A,ACGCCGCCGCCGC,ACGCCGCCGCCGCCGCCGCCGCCGC,ACGCCGCCGCCGCCGCCGCCGC
5922968.43
1
179229634
.
GCCGCCGCCGCCGCCGCCGCCA
GCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCCGCCA,GCCGCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCCGCCA,G
1967041.49
1
179229635
.
C
T
1962023.95
1
179229637
.
G
GCCGCCGCCGCCGCCGCCA,GCCGCCGCCGCCGCCGCCGCCGCCGCCA,T
44750.46
1
179229639
.
C
T
14313.73
1
179229640
.
GCCGCCGCCGCCGCCA
GCCGCCGCCGCCGCCACCGCCGCCGCCGCCA,GCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCA,GCCGCCGCCGCCACCGCCGCCGCCGCCA,GCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCA,G
69226.61
1
179229643
.
GCCGCCGCCGCCA
GCCGCCGCCGCCACCGCCGCCGCCA,GCCGCCGCCGCCGCCGCCACCGCCGCCGCCA,G,GCCGCCGCCACCGCCGCCGCCA,GCCGCCCCCGCCGCCGCCA
13792.26
1
179229645
.
C
G
8597.99
1
179229646
.
GCCGCCGCCA
G,GCCGCCGCCACCGCCGCCA,GCCGCCGCCGCCGCCACCGCCGCCA,GCCGCCGCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCA
72429.30
1
179229649
.
GCCGCCA
G,GCCGCCGCCGCCGCCGCCGCCGCCGCCGCCACCGCCA
50689.02
1
179229652
rs869187553
GCCA
G
74021.53
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
179229630
.
CAACGC
CAA
.
1
179229632
.
ACGC
A
.
1
179229632
rs774004515
ACGC
ACGCCGC,ACGCCGCCGC,ACGCCGCCGCCGC,A
.
1
179229632
.
ACGCCGC
ACGC,A
.
1
179229643
.
GCCGCCGCCGCCA
G
.
1
179229646
.
G
C
.
1
179229646
.
GCCGCCGCCA
G
.
1
179229652
.
G
GCCGCCT
.
1
179229652
rs768016929
GCCA
G
.