| General information of RDP00051 | |
|---|---|
| Gene Symbol: | DEDD |
| RefSeq ID: | NM_001039711 |
| Repeat coordinate: | chr1:161132639-161132660 (-) |
| Repeat size: | 7 |
| Repeat region: | 5' UTR |
| Repeat unit: | CGG |
| Repeat conservation: | PhastCons_score: 0.478; Repeat Conservation from UCSC Genome Browser |
| Amino acid sequence: | - |
| Gene expression and GO annotation: | BioGPS |
| Protein expression: | Human Protein Altas |
| Gene conservation: | Gene Conservation from UCSC Genome Browser |
| Mapping repeat track to 1000 Genomes: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
161132638
.
AGCCGCCGCC
A
100
| Mapping repeat track to gnomAD: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
161132638
rs534289963
AGCCGCCGCC
A,AGCCGCCGCCGCC,AGCCGCCGCCGCCGCC,AGCCGCC,AGCCGCCGCCGCCGCCGCC
289967.22
1
161132643
.
CCGCCGCCGCCGCCGCCGCGGCCGTGGGGGAGGGGACAGGCGGGCGGGGGTGGCTGCATCCTGAACGG
C
73244.20
1
161132650
.
C
T
454.43
| Mapping repeat track to Kaviar: |
|---|
Chr
Pos
dbSNP_ID
Ref
Alt
Qual
1
161132638
rs777138609
AGCC
A
.
1
161132638
rs576251096
AGCCGCCGCC
A
.
1
161132650
.
C
A
.