ISRNA -- Integrative Short Reads NAvigator


ISRNA is an online toolkit for searching, analyzing and visualizing short reads generated from high-throughput sequencing technology. ISRNA is designed to provide easy-to-use yet comprehensive analysis tools for users without any bioinformatics prerequisites.

Click here to find more about ISRNA...

Use ISRNA

Use Demo project Have a preview of the demo dataset
Enter the project name:
Enter the dataset name:
Select the reference genome:
Upload your short sequence reads data:
Read count threshold to remove low abundant sequences:
Email address for result notification: (Optional)
Display advanced options

ISRNA accepts Fastq file format or customized files with read counts in the following format: (preferred)


TGAACGGCGTTCACGGCAGACT    9452
TTCCGTAAGTTCACGGCAGAC    9018
ATCCGGGCGTTCACGGCAGAC    8774
...

The file should contain two tab-delimited columns in each line, the first column is the sequence, and the second column is the read counts of the sequence.

The raw fastq file (.fastq or .fq, often as large as several gigabytes) of one sequencing reaction can be converted to the required format using this script.

Important Notice for Data Privacy

User uploaded data will NOT be used by or distributed to anybody under any circumstance.